Journal: Cell reports

Article Title: Mitochondrial Pyruvate Carrier 1 Promotes Peripheral T Cell Homeostasis through Metabolic Regulation of Thymic Development

doi: 10.1016/j.celrep.2020.02.042

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: Cell Lines To generate MPC1 KO Jurkat T cells, CRISPR/Cas9 lentivector infections were performed as described ( Wallace et al., 2016 , 2017 ) by utilizing Trans-IT 293 (Mirus) to transfect 293T cells (ATCC) with the packaging plasmids pVSVg ( Stewart et al., 2003 ) and psPAX2 along with the CRISPR/Cas9 lentiCRISPRv2 construct ( Sanjana et al., 2014 ) (Addgene plasmid #52961) containing a GFP selection marker and one specific short guide RNA sequence against human MPC1 (MPC1-CR1, 5′-GTCGTGAGGCGGGCCTTCG GGCTGGCTCGCCGTCGGCTGCCGGGGGGTTGGCCGGGGTGTCATTGGCTCTGGGAA GCGGCAGCAGAGGCAGGGACCACTC GGGGTCTGGTGTCGGCACAGCCATGGCGGGC GCGTTGGTGCGGAAAGCGGCGGACTATGTCCGAAGCAAGGATTTCCGGGAC TACCTCA TGAGGTGACGAGCGCCGCAGGCCGAACCC-3′) or an empty vector (EV).

Techniques: Staining, Plasmid Preparation, Recombinant, CRISPR, Construct, Software